Primers & Oligos

Paste a primer to get its melting temperature by the nearest-neighbour method (as used by Primer3 and most primer-design tools), with the simpler Wallace and salt-adjusted rules for comparison, its GC content, molecular weight and extinction coefficient. Add the reverse primer to check that the pair is matched, and an A260 reading for the concentration of your stock.

PCRPrimer designMelting temperature

Inputs

Input examples

Write the sequence 5′ → 3′ with A, C, G and T; spaces and numbers are ignored. The nearest-neighbour Tm uses the SantaLucia (1998) parameters with his salt correction; magnesium and dNTPs are included as a sodium equivalent, as in Primer3 and Biopython. The defaults (50 mM monovalent salt, 50 nM oligo, no Mg²⁺) are Primer3’s; for a typical PCR buffer enter about 1.5–2 mM Mg²⁺, 0.2–0.8 mM dNTPs and 200–500 nM primer, which raises the Tm by several degrees. The extinction coefficient is the sum of the bases and can be about 10–20% off for some sequences.

Forward primer — 5′ → 3′

Reverse primer — optional, 5′ → 3′

Na⁺ + K⁺ — mM

Oligo concentration — nM

Mg²⁺ — mM

dNTPs — mM

Tris — mM

A260 of the stock — optional, undiluted, 1 cm

What Sets the Melting Temperature?

The melting temperature is the temperature at which half of the primer is bound to its target. G·C pairs hold with three hydrogen bonds and stack more strongly than A·T pairs, so GC-rich and longer primers melt at higher temperatures. The quick Wallace rule (2 °C per A or T, 4 °C per G or C) works only for short oligos of about 14–20 bases.

The nearest-neighbour method is far more accurate: it adds the enthalpy and entropy of each pair of neighbouring bases, because stacking depends on the neighbours, not only on the base itself. Salt shields the negative backbones and stabilises the duplex, and so does magnesium, much more strongly per millimole; dNTPs bind magnesium and cancel part of that effect.

Good PCR primers are usually 18–25 bases with 40–60% GC, a Tm of about 55–65 °C, a G or C at the 3′ end, and the two primers within about 2–5 °C of each other. The annealing temperature is typically set a few degrees below the lower Tm.

length18–25 bases

GC40–60%

Tm55–65 °C, pair within 5 °C

Wallaceonly for short oligos

Sequence

GC content, 5-base window

Result

Enter a sequence above

Worked Techniques

Wallace Rule

Count A + T and G + C. Fast, but it ignores the salt and the order of the bases.

Example: a 28-mer with 14 G/C gives 84 °C by this rule, far too high: nearest-neighbour gives 60 °C.

Nearest Neighbours

Each step along the sequence, such as CG or AT, has its own ΔH and ΔS; the two ends add an initiation term. The concentration term is C/4 for two different strands (C/2 if the oligo pairs with itself).

Example: CGTTCCAAAGATGTGGGCATGAGCTTAC: 60.32 °C at 50 mM Na⁺ and 50 nM.

Magnesium as Sodium

In millimolar. 1.5 mM Mg²⁺ counts as 147 mM of sodium, which is why PCR buffers raise the Tm.

Example: the same primer with 10 mM Tris and 1.5 mM Mg²⁺: 67.39 °C.

Sources & Verification

References

J. SantaLucia Jr., “A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics”, Proc. Natl. Acad. Sci. USA 95 (1998) 1460–1465 — the nearest-neighbour parameters, initiation and symmetry terms, and the salt correction 0.368 (N − 1) ln[Na⁺].
N. von Ahsen, C. T. Wittwer and E. Schütz, “Oligonucleotide melting temperatures under PCR conditions”, Clin. Chem. 47 (2001) 1956–1961 — the sodium equivalent of Mg²⁺, Tris and dNTPs.
Biopython, Bio.SeqUtils.MeltingTemp documentation (version 1.88), read 5 November 2026 — the published example values used to check this page.
R. B. Wallace et al., Nucleic Acids Res. 6 (1979) 3543–3557 — the 2 + 4 rule for short oligos.